Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #22051)


Item Catalog # Description Quantity Price (USD)
Plasmid 22051 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 9115
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)
  • Copy number


  • Gene/Insert name
  • Alt name
  • Species
    C. reinhardtii
  • Insert Size (bp)
  • Mutation
  • GenBank ID
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer 5' GCACCTTTTGAAATGTAATC 3'
  • 3′ sequencing primer 5' AGAATACCAGTCAATCTTTCAC 3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Depositor Comments


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Fubi-ChR2-GFP was a gift from Edward Boyden (Addgene plasmid # 22051 ; ; RRID:Addgene_22051)
  • For your References section:

    Millisecond-timescale, genetically targeted optical control of neural activity. Boyden ES, Zhang F, Bamberg E, Nagel G, Deisseroth K. Nat Neurosci. 2005 Sep . 8(9):1263-8. 10.1038/nn1525 PubMed 16116447