This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #22224)


Item Catalog # Description Quantity Price (USD)
Plasmid 22224 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Pavel Osten
  • Backbone size w/o insert (bp) 9227
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)
  • Copy number


  • Gene/Insert name
  • Alt name
  • Alt name
  • Alt name
    H. sodomense archaerhodopsin-3
  • Species
    H. sodomense
  • Insert Size (bp)
  • Mutation
  • Tags / Fusion Proteins
    • ss (N terminal on insert)
    • Prl (N terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer atgactgagaccctcccacccgtg actgaaagcgccgt
  • (Common Sequencing Primers)

Resource Information

Depositor Comments


How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FCK-ss-Prl-Arch-GFP was a gift from Edward Boyden (Addgene plasmid # 22224)
  • For your References section:

    High-performance genetically targetable optical neural silencing by light-driven proton pumps. Chow BY, Han X, Dobry AS, Qian X, Chuong AS, Li M, Henninger MA, Belfort GM, Lin Y, Monahan PE, Boyden ES. Nature. 2010 Jan 7. 463(7277):98-102. 10.1038/nature08652 PubMed 20054397