1
Plasmid 22221: FCK-Arch-CFP
  • Arch

  • Arch-CFP

  • archaerhodopsin-3

  • H. sodomense archaerhodopsin-3

  • 1518

  • H. sodomense

  • CFP

  • C terminal on insert

  • NO

  • FCK(1.3)GW
    (Search Vector Database)

  • Pavel Osten

  • Mammalian Expression, Lentiviral

  • 9227

  • Bam HI

  • No

  • EcoRI

  • No

  • atgactgagaccctcccacccgtg actgaaagcgccgt List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • Use recombinase-free E. coli (e.g., Invitrogen's Stbl3)

  • Unknown

  • View sequences (3)
  • View map

  • Edward Boyden

  • UBMTA
    Ancillary Agreement for Plasmids Containing FP Materials

Comments: 

PLEASE CONTACT ED BOYDEN (esb@media.mit.edu) FOR DETAILS ON THIS REAGENT AND FURTHER REAGENTS IN THIS LINE.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: High-performance genetically targetable optical neural silencing by light-driven proton pumps. Chow et al (Nature. 2010 Jan 7. 463(7277):98-102. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22221" in your Materials and Methods section.