-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22742 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV-DsRed-Express (modified with added BglII and EcoRI sites
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4600
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5 alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemicroRNA 9 binding sites
-
Alt namemir9
-
Insert Size (bp)53
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer Unknown (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDNA cloned within Hudson lab
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
2 miR9 binding sites (TCATACAGCTAGATAACCAAAGA) inserted between BglII and EcoRI site of pDsRed-Sensor. AscI site separates the two binding sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDsRed-miR9 Sensor was a gift from Lynn Hudson (Addgene plasmid # 22742 ; http://n2t.net/addgene:22742 ; RRID:Addgene_22742) -
For your References section:
Identification of dynamically regulated microRNA and mRNA networks in developing oligodendrocytes. Lau P, Verrier JD, Nielsen JA, Johnson KR, Notterpek L, Hudson LD. J Neurosci. 2008 Nov 5. 28(45):11720-30. 10.1523/JNEUROSCI.1932-08.2008 PubMed 18987208