pDsRed-miR9 Sensor
(Plasmid #22742)

• Depositing Lab: Lynn Hudson
• Publication: Lau et al J Neurosci. 2008 Nov 5. 28(45):11720-30.

Backbone

• Vector backbone: pCMV-DsRed-Express (modified with added BglII and EcoRI sites
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4600
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: DH5 alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: microRNA 9 binding sites
• Alt name: mir9
• Insert Size (bp): 53

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: Unknown

Resource Information

• A portion of this plasmid was derived from a plasmid made by: DNA cloned within Hudson lab
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

2 miR9 binding sites (TCATACAGCTAGATAACCAAAGA) inserted between BglII and EcoRI site of pDsRed-Sensor. AscI site separates the two binding sites.