Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CMV::SypHy A4
(Plasmid #24478)


Item Catalog # Description Quantity Price (USD)
Plasmid 24478 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3952
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Rat Synaptophysin-pHluorin
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
  • Entrez Gene
    Syp (a.k.a. Syp1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not destroyed)
  • 3′ cloning site Not1 (destroyed during cloning)
  • 5′ sequencing primer cctctacaaatgtggtatggc
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The depositing lab notes that the Xba1 and Bcl1 unique restriction digestion sites could be methylated and blocked if the plasmid is grown or maintained in dam+ bacteria.

Also note that in the Addgene-generated map below, the feature listed as "GFP(12-708)" is actually pH sensitive pHluorin.

There is a mutation S446T in Synaptophysin ORF. This change does not have any effect in localizing the construct to the synaptic vesicle and may be a result of a SNP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV::SypHy A4 was a gift from Leon Lagnado (Addgene plasmid # 24478 ; ; RRID:Addgene_24478)
  • For your References section:

    Clathrin-mediated endocytosis is the dominant mechanism of vesicle retrieval at hippocampal synapses. Granseth B, Odermatt B, Royle SJ, Lagnado L. Neuron. 2006 Sep 21. 51(6):773-86. 10.1016/j.neuron.2006.08.029 PubMed 16982422