1
Plasmid 24754: pAsylum
  • None

  • N/A
    (Search Vector Database)

  • Christopher Buck lab

  • Cloning vector

  • 1851

  • AsyR (CTGAAAGAGGAACTTGGTTAGG) List of Sequencing Primers

  • Bleocin (Zeocin)

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • Christopher Buck

  • MTA

Comments: 

MCS protected by bacterial transcription terminators.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Schowalter et al (Cell Host Microbe. 2010 Jun 25;7(6):509-15. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 24754" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only