This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pN1-Lck-GCaMP2
(Plasmid #24794)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 24794 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3950
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lck-GCaMP2
  • Alt name
    GCaMP
  • Alt name
    GCaMP2
  • Alt name
    Lck-GCaMP
  • Insert Size (bp)
    1480
  • Mutation
    Plasmid contains N-terminal 26 amino acid membrane targeting sequence of Lck (Src tyrosine kinase) fused to GCaMP2. 6xHis and Xpress (FLAG-like) epitope tags contained within 'RSET' sequence, making up the linker region between Lck and GCaMP2
  • Tags / Fusion Proteins
    • His
    • Xpress

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ACGGTGGGAGGTCTATATAAGCAGAG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN1-Lck-GCaMP2 was a gift from Baljit Khakh (Addgene plasmid # 24794 ; http://n2t.net/addgene:24794 ; RRID:Addgene_24794)
  • For your References section:

    A genetically targeted optical sensor to monitor calcium signals in astrocyte processes. Shigetomi E, Kracun S, Sofroniew MV, Khakh BS.. Nat Neurosci. 2010 Jun;13(6):759-66. 10.1038/nn.2557 PubMed 20495558