1
Plasmid 25027: pIS1-miR-206 site
  • synthetic miR-206 site

  • miR-206 binding site

  • miR-206 reporter

  • 23

  • pIS1
    (Search Vector Database)

  • David Bartel, Addgene plasmid # 12179

  • Mammalian Expression, Luciferase

  • 4085

  • SacI

  • Unknown

  • AgeI

  • Unknown

  • Rluc-F (ccaggattcttttccaatgc) List of Sequencing Primers

  • EBV-rev

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Bob Weinberg

  • UBMTA
    Luciferase Limited Use Label License

Comments: 

Renilla luciferase reporter for miR-206 constructed by cloning oligo containing synthetic miR-206 binding site (GCCATTGAGCTCTGGAATGTAAGGAAGTGTGTGGACCGGTGCCATT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan et al (Cell. 2009 Jun 12. 137(6):1032-46. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 25027" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only