1
Plasmid 12179: pIS1
  • None

  • pIS1
    (Search Vector Database)

  • Bartel Lab

  • Mammalian Expression, Luciferase

  • 4085

  • n/a List of Sequencing Primers

  • EBV rev primer (GTGGTTTGTCCAAACTCATC)

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • David Bartel

  • MTA
    Luciferase Limited Use Label License

Comments: 

pIS1 was derived from pRL-TK by adding more cloning sites. The plasmid contains a renilla luciferase reporter driven by the HSV TK promoter. Search Addgene's vector database for more information on pRL-TK from Promega.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 12179" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only