Plasmid 12177: pIS2

• Gene/insert name: None
• Vector backbone: pIS2
  (Search Vector Database)
• Backbone manufacturer: David Bartel Lab
• Vector type: Mammalian Expression, Luciferase
• Backbone size (bp): 3745
• 5' sequencing primer: EBV rev primer (GTGGTTTGTCCAAACTCATC)
• Bacterial resistance(s) Ampicillin
• Growth strain(s) DH5alpha
• Growth temperature (℃): 37
• High or low copy: High Copy
• Sequence: View sequences (2)
• Principal Investigator: David Bartel
• Terms and Licenses: MTA
  Luciferase Limited Use Label License

Comments: 

pIS2 was derived from pRL-SV40. More cloning sites have been added (the lower case is the pRL-SV40 and the caps is the new sequence that has been inserted): gaacaataattctagGAGCTCTATACCGGTCTCGATATCACTACTAGTGTtctagagcggccgct . The plasmid contains a renilla luciferase reporter driven by the SV40 early enhancer/promoter. Search Addgene's vector database for more information on pRL-SV40 from Promega.

Article: The widespread impact of mammalian MicroRNAs on mRNA repression and evolution. Farh et al (Science. 2005 Dec 16. 310(5755):1817-21. PubMed)