Renilla luciferase reporter for miR-31. Oligos including miR-31 synthetic binding site (AATGGCGAGCTCAGGCAAGATGCTGGCAT AGCTACCGGTAATGGC) were cloned into the SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.
Addgene has sequenced a portion of this plasmid for verification.
Click here for the sequencing
result.
Please acknowledge the principal investigator and cite this article if you use
this plasmid in a publication. Also, please include the text "Addgene plasmid
25021" in your Materials and Methods section.
Renilla luciferase reporter for miR-31. Oligos including miR-31 synthetic binding site (AATGGCGAGCTCAGGCAAGATGCTGGCAT AGCTACCGGTAATGGC) were cloned into the SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.