CMV-miR-31 sponge
(Plasmid
#25025)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25025 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA5-CMV-d2eGFP
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCMV-miR-31 sponge
-
Alt nametransient miR-31 sponge
-
Insert Size (bp)200
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site ApaI (unknown if destroyed)
- 5′ sequencing primer CMV-d2eGFP-F, TATATCATGGCCGACAAGC
- 3′ sequencing primer BGH-rev (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
miR-31 sponge generated by cloning oligonucleotides containing seven tandem “bulged” (at positions 9-12) miR-31 binding motifs (AGGCAAGACGAGGCATAGCT) into the XhoI and ApaI sites of the CMV sponge backbone.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-miR-31 sponge was a gift from Bob Weinberg (Addgene plasmid # 25025 ; http://n2t.net/addgene:25025 ; RRID:Addgene_25025) -
For your References section:
A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507