1
Plasmid 25025: CMV-miR-31 sponge
  • CMV-miR-31 sponge

  • transient miR-31 sponge

  • 200

  • pcDNA5-CMV-d2eGFP
    (Search Vector Database)

  • Invitrogen

  • Mammalian Expression

  • 5000

  • XhoI

  • Unknown

  • ApaI

  • Unknown

  • CMV-d2eGFP-F, TATATCATGGCCGACAAGC List of Sequencing Primers

  • BGH-rev

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • Bob Weinberg

  • MTA

Comments: 

miR-31 sponge generated by cloning oligonucleotides containing seven tandem “bulged” (at positions 9-12) miR-31 binding motifs (AGGCAAGACGAGGCATAGCT) into the XhoI and ApaI sites of the CMV sponge backbone.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan et al (Cell. 2009 Jun 12. 137(6):1032-46. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 25025" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only