CMV-miR-31 sponge
(Plasmid #25025)

• Depositing Lab: Bob Weinberg
• Publication: Valastyan et al Cell. 2009 Jun 12. 137(6):1032-46.

Backbone

• Vector backbone: pcDNA5-CMV-d2eGFP
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5000
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CMV-miR-31 sponge
• Alt name: transient miR-31 sponge
• Insert Size (bp): 200

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (unknown if destroyed)
• 3′ cloning site: ApaI (unknown if destroyed)
• 5′ sequencing primer: CMV-d2eGFP-F, TATATCATGGCCGACAAGC
• 3′ sequencing primer: BGH-rev

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

miR-31 sponge generated by cloning oligonucleotides containing seven tandem “bulged” (at positions 9-12) miR-31 binding motifs (AGGCAAGACGAGGCATAGCT) into the XhoI and ApaI sites of the CMV sponge backbone.