Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

CMV-miR-31 sponge
(Plasmid #25025)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 25025 Plasmid sent as bacteria in agar stab 1 $65 Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    CMV-miR-31 sponge
  • Alt name
    transient miR-31 sponge
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site ApaI (unknown if destroyed)
  • 5′ sequencing primer CMV-d2eGFP-F, TATATCATGGCCGACAAGC
  • 3′ sequencing primer BGH-rev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

miR-31 sponge generated by cloning oligonucleotides containing seven tandem “bulged” (at positions 9-12) miR-31 binding motifs (AGGCAAGACGAGGCATAGCT) into the XhoI and ApaI sites of the CMV sponge backbone.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-miR-31 sponge was a gift from Bob Weinberg (Addgene plasmid # 25025)
  • For your References section:

    A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan S, Reinhardt F, Benaich N, Calogrias D, Szasz AM, Wang ZC, Brock JE, Richardson AL, Weinberg RA. Cell. 2009 Jun 12. 137(6):1032-46. 10.1016/j.cell.2009.03.047 PubMed 19524507