Plasmid 22694: pBABE-puro-mIR-31 sponge
  • Stable suppression of miR-31 function

  • miR-31

  • stable miR-31 sponge

  • 1100

  • H. sapiens (human)

  • MIR31 (MIRN31, hsa-mir-31, miR-31)

  • *

  • N terminal on backbone

  • miR-31 sponge with 7x tandem binding sites to the microRNA.

  • pBABE-puro
    (Search Vector Database)

  • Weinberg lab (Addgene#:1764)

  • Mammalian Expression, Retroviral

  • 5169

  • BamHI

  • No

  • ApaI

  • No

  • pBabe-5 List of Sequencing Primers

  • pBabe-3

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • View sequences (2)
  • Bob Weinberg



Useful for stable suppression of miR-31 function.

Original sponge backbone modifed from Ebert et al., Nat. Methods (2007); miR-31 construct and stable design are novel

Repeated sequence is: AGGCAAGACGAGGCATAGCT

*Addgene sequencing found at least partial EGFP upstream of the sponge. We do not know if the EGFP is functional or a side-product of the cloning.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan et al (Cell. 2009 Jun 12. 137(6):1032-46. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 22694" in your Materials and Methods section.