Renilla luciferase reporter for miR-335 constructed by cloning oligo containing synthetic miR-335 binding site (GCCAGTGAGCTCTCAAGAGCAATAACGAAAAATGTACCGGTGCCAGT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.
Addgene has sequenced a portion of this plasmid for verification.
Click here for the sequencing
result.
Please acknowledge the principal investigator and cite this article if you use
this plasmid in a publication. Also, please include the text "Addgene plasmid
25028" in your Materials and Methods section.
Renilla luciferase reporter for miR-335 constructed by cloning oligo containing synthetic miR-335 binding site (GCCAGTGAGCTCTCAAGAGCAATAACGAAAAATGTACCGGTGCCAGT) into SacI and AgeI sites of the 3’ UTR of a pIS1 vector backbone.