MDH1-PGK-GFP-miR9
(Plasmid #25036)

Loading...
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    MDH1-PGK-GFP 2.0
  • Backbone manufacturer
    Chang-Zheng Chen, Addgene plasmid 11375
  • Backbone size w/o insert (bp) 6963
  • Vector type
    Mammalian Expression, Retroviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    mir-9-3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    313
  • Entrez Gene
    MIR9-3 (a.k.a. MIRN9-3, miRNA9-3, hsa-mir-9-3)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer EGFP-C
  • 3′ sequencing primer H1, tcgctatgtgttctgggaaa
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The mir-9-3 gene was PCR-amplified from normal human genomic DNA and cloned into the MDH-PGK-GFP 2.0 retroviral vector. It includes the miR-9 stem-loop and ~100bp flanking sequences on both sides.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MDH1-PGK-GFP-miR9 was a gift from Bob Weinberg (Addgene plasmid # 25036)
  • For your References section:

    miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Ma L, Young J, Prabhala H, Pan E, Mestdagh P, Muth D, Teruya-Feldstein J, Reinhardt F, Onder TT, Valastyan S, Westermann F, Speleman F, Vandesompele J, Weinberg RA. Nat Cell Biol. 2010 Mar . 12(3):247-56. 10.1038/ncb2024 PubMed 20173740