1
Plasmid 25036: MDH1-PGK-GFP-miR9
  • mir-9-3

  • 313

  • H. sapiens (human)

  • MIR9-3 (MIRN9-3, miRNA9-3, hsa-mir-9-3)

  • MDH1-PGK-GFP 2.0
    (Search Vector Database)

  • Chang-Zheng Chen, Addgene plasmid 11375

  • Mammalian Expression, Retroviral, RNAi

  • 6963

  • EcoRI

  • Unknown

  • XhoI

  • Unknown

  • EGFP-C List of Sequencing Primers

  • H1, tcgctatgtgttctgggaaa

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Bob Weinberg

  • MTA

Comments: 

The mir-9-3 gene was PCR-amplified from normal human genomic DNA and cloned into the MDH-PGK-GFP 2.0 retroviral vector. It includes the miR-9 stem-loop and ~100bp flanking sequences on both sides.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Ma et al (Nat Cell Biol. 2010 Mar . 12(3):247-56. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 25036" in your Materials and Methods section.