1
Plasmid 26089: pIS1-wt RhoA 3'UTR
  • wt RhoA 3'UTR

  • wt RhoA reporter

  • RhoA

  • 1061

  • H. sapiens (human)

  • RHOA (ARH12, ARHA, RHO12, RHOH12)

  • pIS1
    (Search Vector Database)

  • David Bartel, Addgene plasmid # 12179

  • Mammalian Expression, Luciferase

  • 4085

  • SacI

  • Unknown

  • AgeI

  • Unknown

  • Rluc-F (ccaggattcttttccaatgc) List of Sequencing Primers

  • EBV-rev

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Bob Weinberg

  • UBMTA

Comments: 

Renilla luciferase reporter controlled by RhoA 3'UTR containing wild-type miR-31 binding sites.
The miR-31 motif at nucleotides 145-151 of the human RhoA 3’ UTR is ATCTTGC. The miR-31 motif
spanning nucleotides 303-309 of the RhoA 3’ UTR is TCTTGC.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan et al (Cell. 2009 Jun 12. 137(6):1032-46. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26089" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only