1
Plasmid 26090: pIS1-mutant RhoA 3'UTR
  • mutant RhoA 3'UTR

  • mutant RhoA reporter

  • RhoA

  • 1061

  • H. sapiens (human)

  • RHOA (ARH12, ARHA, RHO12, RHOH12)

  • Both miR-31 binding sites in 3’ UTR mutagenized. Site 1: from ATCTTGC to AGGCGGC. Site 2: from TCTTGC to CGCCGC.

  • pIS1
    (Search Vector Database)

  • David Bartel, Addgene plasmid # 12179

  • Mammalian Expression, Luciferase

  • 4085

  • SacI

  • Unknown

  • AgeI

  • Unknown

  • Rluc-F (ccaggattcttttccaatgc) List of Sequencing Primers

  • EBV-rev

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (1)
  • Bob Weinberg

  • UBMTA

Comments: 

Renilla luciferase reporter controlled by RhoA 3'UTR containing site-directed mutagenized miR-31 binding sites.

There is also a G->A mutation in the insert. The Weinberg lab has determined that this mutation does not affection function.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: A pleiotropically acting microRNA, miR-31, inhibits breast cancer metastasis. Valastyan et al (Cell. 2009 Jun 12. 137(6):1032-46. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26090" in your Materials and Methods section.