Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pLenti CMV rtTA3 Blast (w756-1)
(Plasmid #26429)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26429 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 26429-LV Virus (1 mL at titer > 5x10⁵ TU/mL)
and Plasmid. More Information
$250

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p156RRL-sinPPT-CMV-GFP-PRE/Nhe I
  • Backbone size w/o insert (bp) 7681
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Stbl3, 37oC.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tetracycline repressor A3 mutant
  • Alt name
    rtTA3
  • Insert Size (bp)
    707

Cloning Information

Resource Information

Depositor Comments

Use to make them Tet-On Advanced.

There are a few mismatches between Addgene's sequence and Dr Campeau's sequence. The sequence difference does not affect expression of the rtTA3.

Information for Lentiviral Prep (Catalog # 26429-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from pLenti CMV rtTA3 Blast (w756-1) (#26429). In addition to the viral particles, you will also receive purified pLenti CMV rtTA3 Blast (w756-1) plasmid DNA.

Lentiviral particles carrying the rtTA3 transactivator protein and blasticidin resistance.

Delivery

  • Volume 1 mL
  • Titer ≥5x10⁵ TU/mL
  • Pricing $220 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker Blasticidin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 26429-LV and treated with blasticidin. Blasticidin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
Notes:
  • PCR confirmation of insert: PCR was carried out with primers targeting the CMV promoter and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: CMV-F GTAACAACTCCGCCCCATT
    Reverse Primer: WPRE-R CATAGCGTAAAAGGAGCAACA
  • Confirmation of protein expression: A549 cells were transduced with 26429-LV at an MOI of 1 and treated with blasticidin. Polyclonal pools of blasticidin-resistant cells were expanded, collected, lysed and tested for rtTA expression via immunoblotting. You can view the stable cell line expression data here or in the image section at the top of this page. Read our protocol for generating stable cell lines here.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CMV rtTA3 Blast (w756-1) was a gift from Eric Campeau (Addgene plasmid # 26429)