Plasmid 29766: MSCV puro let-7 sponge
  • let-7 sponge

  • 150

  • MSCV puro
    (Search Vector Database)

  • Mammalian Expression, Retroviral

  • 6000

  • XhoI

  • No

  • blunt

  • Unknown

  • pLXSN-5 List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • View sequences (1)
  • Cloning information from depositor (application/x-pdf)

  • Phil Sharp



The let-7 family sponge contains six bulged sites with alternating sequences AACUAUACAAGGACUACCUCA and AACUAUACAAUGACUACCUCA. The binding sites are for a consensus sequence of all mammalian let-7 miRNAs

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Suppression of non-small cell lung tumor development by the let-7 microRNA family. Kumar et al (Proc Natl Acad Sci U S A. 2008 Feb 28. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 29766" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only