MSCV puro let-7 sponge
(Plasmid #29766)

Loading...
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    MSCV puro
  • Backbone size w/o insert (bp) 6000
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    let-7 sponge
  • Insert Size (bp)
    150

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site blunt (unknown if destroyed)
  • 5′ sequencing primer pLXSN-5
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The let-7 family sponge contains six bulged sites with alternating sequences AACUAUACAAGGACUACCUCA and AACUAUACAAUGACUACCUCA. The binding sites are for a consensus sequence of all mammalian let-7 miRNAs

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MSCV puro let-7 sponge was a gift from Phil Sharp (Addgene plasmid # 29766)
  • For your References section:

    Suppression of non-small cell lung tumor development by the let-7 microRNA family. Kumar MS, Erkeland SJ, Pester RE, Chen CY, Ebert MS, Sharp PA, Jacks T. Proc Natl Acad Sci U S A. 2008 Feb 28. ():. 10.1073/pnas.0712321105 PubMed 18308936