1
Plasmid 32497: pLKO.1-GSK3β-#2
  • GSK3B

  • (AAA)GCTAGATCACTGTAACA

  • H. sapiens (human)

  • GSK3B ()

  • pLKO.1
    (Search Vector Database)

  • Sabatini Lab

  • Mammalian Expression, Lentiviral, RNAi

  • 7000

  • U6

  • None

  • Unknown

  • None

  • Unknown

  • LKO.1 (GACTATCATATGCTTACCGT) List of Sequencing Primers

  • none

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • View sequences (1)
  • Alex Toker

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Akt/protein kinase b and glycogen synthase kinase-3beta signaling pathway regulates cell migration through the NFAT1 transcription factor. Yoeli-Lerner et al (Mol Cancer Res. 2009 Mar;7(3):425-32. Epub 2009 Mar 3. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32497" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only