pTYF-G4BS-3.6TPH-EGFP
(Plasmid #32570)

Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    EGFP
  • Species
    jellyfish
  • Insert Size (bp)
    798
  • Promoter 3.6TPH

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer atggtgagcaagggcgaggag
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that Addgene's quality control sequence shows A inserted relative to the author's sequence. There is no evidence that this insertion affects the function of the plasmid.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTYF-G4BS-3.6TPH-EGFP was a gift from Sergey Kasparov (Addgene plasmid # 32570)
  • For your References section:

    Targeting central serotonergic neurons with lentiviral vectors based on a transcriptional amplification strategy. Benzekhroufa K, Liu BH, Teschemacher AG, Kasparov S. Gene Ther. 2009 May;16(5):681-8. Epub 2009 Feb 12. 10.1038/gt.2009.7 PubMed 19212426