1
Plasmid 34616: pJMK004
  • Arch D95N

  • Archaerhodopsin 3

  • 777

  • Halorubrum sodomense

  • GFP

  • C terminal on insert

  • Changed Aspartic Acid 95 to Asparagine

  • FCK(1.3)
    (Search Vector Database)

  • Pavel Osten

  • Mammalian Expression, Lentiviral

  • 9227

  • BamHI

  • No

  • EcoRI

  • No

  • GACGGATCCGCCACCATGGAC List of Sequencing Primers

  • CTAATCGAATTCTTAGTCGGCGGCAC

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • Adam Cohen

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Optical recording of action potentials in mammalian neurons using a microbial rhodopsin. Kralj et al (Nat Methods. 2011 Nov 27. doi: 10.1038/nmeth.1782. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 34616" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only