Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #33780)


Item Catalog # Description Quantity Price (USD)
Plasmid 33780 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4127
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    Grow E. coli to early-log phase (OD600 = 0.3 ~ 0.4) in 50 mL of LB medium in a shaking incubator at 33 C. Add inducer along with all-trans retinal (5 microM from a 20 mM stock in ethanol) and conduct further growth in the dark. Harvest cells after 3.5 hours and wash with 30 mL of minimal medium (1x M9 salts, 0.4% glucose, pH 7). Resuspend cells in 5 mL minimal medium and use immediately or store at 4 C for later use.
  • Copy number
    High Copy


  • Gene/Insert name
    Proteorhodopsin Optical Proton Sensor
  • Alt name
  • Alt name
    Proteorhodopsin D97N
  • Species
    uncultured proteobacterium EBAC31A08
  • Insert Size (bp)
  • GenBank ID
  • Promoter AraBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMK001 was a gift from Adam Cohen (Addgene plasmid # 33780)
  • For your References section:

    Electrical spiking in Escherichia coli probed with a fluorescent voltage-indicating protein. Kralj JM, Hochbaum DR, Douglass AD, Cohen AE. Science. 2011 Jul 15;333(6040):345-8. 10.1126/science.1204763 PubMed 21764748