1
Plasmid 35520: pLenti-CaMKIIa-C1C2-TS-EYFP
  • ChR1-ChR2 Chimera

  • C1C2

  • 1830

  • Chlamydomonas reinhardtii

  • Trafficking signal and EYFP

  • C terminal on insert

  • pLenti-CaMKIIa
    (Search Vector Database)

  • Mammalian Expression, Lentiviral

  • 9226

  • Has a CaMKIIa promoter and a WPRE

  • CaMKIIa

  • BamHI

  • No

  • EcoRI

  • No

  • AGTCCTGCAGTATTGTGTAT List of Sequencing Primers

  • GCAATAGCATGATACAAAGG

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • View sequences (4)
  • View map

  • Karl Deisseroth

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Crystal structure of the channelrhodopsin light-gated cation channel. Kato et al (Nature. 2012 Jan 22. doi: 10.1038/nature10870. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35520" in your Materials and Methods section.