This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #36186)


Item Catalog # Description Quantity Price (USD)
Plasmid 36186 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 6561
  • Modifications to backbone
    Golden Gate compatible (see Cermak, et al., 2011) expression vector for TALENs. TAL-DNA binding domain can be removed via BamHI and XbaI digestion.
  • Vector type
    Yeast Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    FokI homodimeric Nuclease domain
  • Mutation
    delta152,+63 truncation to TAL backbone
  • Promoter TEV
  • Tag / Fusion Protein
    • ACV5 (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer atcgcgcaatgcactgacgggtg
  • 3′ sequencing primer ttaaaagtttatctcaccg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZHY500 was a gift from Daniel Voytas (Addgene plasmid # 36186)
  • For your References section:

    TALENs enable efficient plant genome engineering. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF. Plant Physiol. 2012 Nov 2. 10.1104/pp.112.205179 PubMed 23124327