Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJFRC81-10XUAS-IVS-Syn21-GFP-p10
(Plasmid #36432)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 36432 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJFRC-MUH
  • Backbone size w/o insert (bp) 8508
  • Total vector size (bp) 8589
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Insert Size (bp)
    717

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG
  • 3′ sequencing primer p10 R: CGGCCAAATGTTAAACTTGGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJFRC81-10XUAS-IVS-Syn21-GFP-p10 was a gift from Gerald Rubin (Addgene plasmid # 36432 ; http://n2t.net/addgene:36432 ; RRID:Addgene_36432)
  • For your References section:

    Using translational enhancers to increase transgene expression in Drosophila. Pfeiffer BD, Truman JW, Rubin GM. Proc Natl Acad Sci U S A. 2012 Apr 9. 10.1073/pnas.1204520109 PubMed 22493255