psiCHECK2-AS34a
(Plasmid
#37099)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37099 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepsiCHECK2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6273
- Total vector size (bp) 6296
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameperfect complementary binding site for hsa-miR-34a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)23
-
Entrez GeneMIR34A (a.k.a. MIRN34A, miRNA34A, mir-34, mir-34a)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer psiCHECK_1402fw: 5'GTCCGCAACTACAACGCCTACCTT3' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCHECK2-AS34a was a gift from Judy Lieberman (Addgene plasmid # 37099 ; http://n2t.net/addgene:37099 ; RRID:Addgene_37099) -
For your References section:
miR-34a contributes to megakaryocytic differentiation of K562 cells independently of p53. Navarro F, Gutman D, Meire E, Caceres M, Rigoutsos I, Bentwich Z, Lieberman J. Blood. 2009 Sep 3. 114(10):2181-92. 10.1182/blood-2009-02-205062 PubMed 19584398