Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #37099)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 37099 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6273
  • Total vector size (bp) 6296
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    perfect complementary binding site for hsa-miR-34a
  • Species
    H. sapiens (human)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer psiCHECK_1402fw: 5'GTCCGCAACTACAACGCCTACCTT3'
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK2-AS34a was a gift from Judy Lieberman (Addgene plasmid # 37099 ; ; RRID:Addgene_37099)
  • For your References section:

    miR-34a contributes to megakaryocytic differentiation of K562 cells independently of p53. Navarro F, Gutman D, Meire E, Caceres M, Rigoutsos I, Bentwich Z, Lieberman J. Blood. 2009 Sep 3. 114(10):2181-92. 10.1182/blood-2009-02-205062 PubMed 19584398