Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET-DUET-GST-eIF4G1-His6, eIF4E
(Plasmid #37232)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37232 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pETDuet-1
  • Backbone manufacturer
    EMD bioscience
  • Backbone size w/o insert (bp) 5420
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    TIF4631
  • Alt name
    eIF4G1
  • Species
    S. cerevisiae (budding yeast)
  • Entrez Gene
    TIF4631 (a.k.a. YGR162W)
  • Promoter T7
  • Tags / Fusion Proteins
    • GST (N terminal on insert)
    • His6 (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer pET Upstream (ATGCGTCCGGCGTAGA)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    CDC33
  • Alt name
    eIF4E
  • Species
    S. cerevisiae (budding yeast)
  • Entrez Gene
    CDC33 (a.k.a. YOL139C, TIF45)
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer DuetUP2 (TTGTACACGGCCGCATAATC)
  • 3′ sequencing primer T7-term
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-DUET-GST-eIF4G1-His6, eIF4E was a gift from Jon Lorsch (Addgene plasmid # 37232 ; http://n2t.net/addgene:37232 ; RRID:Addgene_37232)
  • For your References section:

    The 5'-7-methylguanosine cap on eukaryotic mRNAs serves both to stimulate canonical translation initiation and to block an alternative pathway. Mitchell SF, Walker SE, Algire MA, Park EH, Hinnebusch AG, Lorsch JR. Mol Cell. 2010 Sep 24;39(6):950-62. 10.1016/j.molcel.2010.08.021 PubMed 20864040