Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMXs-IP HA-Parkin
(Plasmid #38248)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 38248 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMXs-IP
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 5800
  • Total vector size (bp) 7300
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Parkin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1398
  • GenBank ID
    NM_004562
  • Entrez Gene
    PRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer aaggaaaaaagcggccgcgtaccatggcttacccatacga
  • 3′ sequencing primer aaggaaaaaagcggccgcctacacgtcgaaccagtggtc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Drs.Noriyuki Matsuda & Keiji Tanaka (Tokyo Metropolitan Institute of Medical Science)
  • Terms and Licenses
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-IP HA-Parkin was a gift from Noboru Mizushima (Addgene plasmid # 38248 ; http://n2t.net/addgene:38248 ; RRID:Addgene_38248)
  • For your References section:

    Parkin mediates proteasome-dependent protein degradation and rupture of the outer mitochondrial membrane. Yoshii SR, Kishi C, Ishihara N, Mizushima N. J Biol Chem. 2011 Jun 3;286(22):19630-40. Epub 2011 Mar 18. 10.1074/jbc.M110.209338 PubMed 21454557