CXN-BCL-6 ZFΔ (pCXN2-BCL6-ZFdel)
(Plasmid #40347)

• Depositing Lab: Alexander Dent
• Publication: Vasanwala et al J Immunol. 2002 Aug 15;169(4):1922-9.

Backbone

• Vector backbone: pCXN2
• Backbone manufacturer: Niwa, Yamamura, and Miyazaki (PMID: 1660837)
• Backbone size w/o insert (bp): 5200
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BCL-6 ZFΔ
• Alt name: BCL-6
• Species: H. sapiens (human)
• Mutation: Contains aa1-504; ZF domain deleted (see note below)
• Entrez Gene: BCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
• Promoter: pCAG

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: pCAG-F
• 3′ sequencing primer: Bglob-pA-R (ttttggcagagggaaaaaga)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The CXN-BCL-6 ZF deletion was made by digesting pBS-BCL-6FL with AspI, which cleaves a unique site in the human BCL-6 cDNA 45 bp before the start of the ZF domain, and HindIII, which cleaves the pBS vector. The digested plasmid was separated from the smaller deleted fragment, and ligated. The truncated cDNA was then cloned into pCXN2 via SalI and XhoI.