Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Zebrafish-gRNA-0002
(Plasmid #42242)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 42242 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    DR274
  • Backbone manufacturer
    Joung lab (Addgene plasmid# 42250)
  • Backbone size w/o insert (bp) 2147
  • Vector type
    CRISPR ; zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA-drd3
  • Alt name
    DR336
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    20
  • Entrez Gene
    drd3
  • Promoter T7

Cloning Information

Resource Information

  • Terms and Licenses

Depositor Comments

Target site: GGAAACTACAGCCCAGCGTC

Guide RNA sequence: TAATACGACTCACTATAGGAAACTACAGCCCAGCGTCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA

For more information on Joung Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/jounglab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Zebrafish-gRNA-0002 was a gift from Keith Joung (Addgene plasmid # 42242 ; http://n2t.net/addgene:42242 ; RRID:Addgene_42242)
  • For your References section:

    Efficient genome editing in zebrafish using a CRISPR-Cas system. Hwang WY, Fu Y, Reyon D, Maeder ML, Tsai SQ, Sander JD, Peterson RT, Yeh JR, Joung JK. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. 10.1038/nbt.2501 PubMed 23360964