-
PurposeEncodes a gRNA that targets Can1.Y in yeast.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 43803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep426
- Backbone size w/o insert (bp) 5886
- Total vector size (bp) 6274
-
Vector typeYeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAN1.y gRNA
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)488
-
Entrez GeneCAN1 (a.k.a. YEL063C)
- Promoter SNR52
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T3 promoter
- 3′ sequencing primer T7 promoter (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For more information on Church Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/church/
gRNA target sequence GATACGTTCTCTATGGAGGA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p426-SNR52p-gRNA.CAN1.Y-SUP4t was a gift from George Church (Addgene plasmid # 43803 ; http://n2t.net/addgene:43803 ; RRID:Addgene_43803) -
For your References section:
Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Dicarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM.. Nucleic Acids Res 10.1093/nar/gkt135 PubMed 23460208