Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGEN-luxCDABE
(Plasmid #44918)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44918 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGENlux
  • Backbone manufacturer
    M. Chelsea Lane
  • Backbone size w/o insert (bp) 11000
  • Total vector size (bp) 11119
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    sigma 70 promoter
  • Alt name
    em7
  • Species
    synthetic construct
  • Insert Size (bp)
    200
  • Promoter em7
  • Tag / Fusion Protein
    • lux transcriptional fusion

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site SnaBI (not destroyed)
  • 5′ sequencing primer CATATGAAGCTTGGTACCGGGATC
  • 3′ sequencing primer CTTTCGGGAAAGATTTCAACCTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    James Galen, Ph.D. University of Maryland
  • Terms and Licenses
  • Article Citing this Plasmid

Depositor Comments

original source is pGEN222

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEN-luxCDABE was a gift from Harry Mobley (Addgene plasmid # 44918 ; http://n2t.net/addgene:44918 ; RRID:Addgene_44918)
  • For your References section:

    Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Lane MC, Alteri CJ, Smith SN, Mobley HL. Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16669-74. Epub 2007 Oct 9. 10.1073/pnas.0607898104 PubMed 17925449