-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44918 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGENlux
-
Backbone manufacturerM. Chelsea Lane
- Backbone size w/o insert (bp) 11000
- Total vector size (bp) 11119
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesigma 70 promoter
-
Alt nameem7
-
Speciessynthetic construct
-
Insert Size (bp)200
- Promoter em7
-
Tag
/ Fusion Protein
- lux transcriptional fusion
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (not destroyed)
- 3′ cloning site SnaBI (not destroyed)
- 5′ sequencing primer CATATGAAGCTTGGTACCGGGATC
- 3′ sequencing primer CTTTCGGGAAAGATTTCAACCTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJames Galen, Ph.D. University of Maryland
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
original source is pGEN222
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEN-luxCDABE was a gift from Harry Mobley (Addgene plasmid # 44918 ; http://n2t.net/addgene:44918 ; RRID:Addgene_44918) -
For your References section:
Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. Lane MC, Alteri CJ, Smith SN, Mobley HL. Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16669-74. Epub 2007 Oct 9. 10.1073/pnas.0607898104 PubMed 17925449