Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGL3 BRE Luciferase
(Plasmid #45126)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45126 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Vector type
    Mammalian Expression, Luciferase ; BMP/Smad Transcriptional Reporter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Id1-BRE
  • Alt name
    BRE-Luc reporter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer RVprimer3
  • 3′ sequencing primer LucNRev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Synthetic oligonucleotides containing two CAGC sites, GGCGCC palindrome and MluI 5′-overhang (on the sense strand) and two SBE sites, one GGCG site and NheI 5′-overhang (on the antisense strand) were ligated and inserted into NheI sites in pGL3-MLP-luc minimal promoter vector. Thus the construct was created with a 5′ site for NheI site followed by 2 SBEs, 1 GGCG site, 2 CAGC′ sites, 2 GGCGCC palindromes, 2 CAGC′ sites, 1 GGCG site, 2 SBEs, and an NheI 3′ site.

Based on the above description and the associated publication, the deduced sequence of the full hairpin is:
GCTAGCTCAGACCGTTAGACGCCAGGACGGGCTGTCAGGCTGGCGCCG CGGCGCCAGCCTGACAGCCCGTCCTGGCGTCTAACGGTCTGAGCTAGC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3 BRE Luciferase was a gift from Martine Roussel & Peter ten Dijke (Addgene plasmid # 45126 ; http://n2t.net/addgene:45126 ; RRID:Addgene_45126)
  • For your References section:

    Identification and functional characterization of distinct critically important bone morphogenetic protein-specific response elements in the Id1 promoter. Korchynskyi O, ten Dijke P. J Biol Chem. 2002 Feb 15;277(7):4883-91. Epub 2001 Nov 29. 10.1074/jbc.M111023200 PubMed 11729207