pLenti-Arch-EEQ
(Plasmid #45188)

• Purpose: Arch voltage indicator with double mutations D95Q-D106E (Arch-EEQ), with faster kinetics and greater fluorescence dynamic range than Arch-D95N
• Depositing Lab: Mark Schnitzer
• Publication: Gong et al PLoS One. 2013 Jun 19;8(6):e66959.

Backbone

• Vector backbone: pLenti-CaMKIIa-eArch 3.0-EYFP (Addgene plasmid# 35514)
• Backbone manufacturer: Karl Deisseroth
• Backbone size w/o insert (bp): 9239
• Total vector size (bp): 10793
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use Amp at 50ug/mL
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: enhanced Archaerhodopsin
• Alt name: Arch-EEQ
• Species: Synthetic; H. sodomense
• Insert Size (bp): 1554
• Mutation: D95Q, D106E
• Promoter: CamKIIa
• Tag / Fusion Protein:
  • eYFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ctgacgaaggctcgcgaggc
• 3′ sequencing primer: gccatacgggaagcaatagcatg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry