Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #45198)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 45198 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 5320
  • Modifications to backbone
    Ligation-independent cloning (LIC) adaptor added to pBABE cloning site: GCACACCATCTCACGTGGAATGTGAG CGTGTGGTAGAGTGCACCTTACACTC
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer pBABE 5'
  • 3′ sequencing primer pBABE 3'
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBLIC-neo was a gift from Priyamvada Rai (Addgene plasmid # 45198 ; ; RRID:Addgene_45198)
  • For your References section:

    Creation and validation of a ligation-independent cloning (LIC) retroviral vector for stable gene transduction in mammalian cells. Patel A, Munoz A, Halvorsen K, Rai P. BMC Biotechnol. 2012 Jan 16;12:3. doi: 10.1186/1472-6750-12-3. 10.1186/1472-6750-12-3 PubMed 22248071