Plasmid 45831: pRS316-4M5.3
  • 4M5.3

  • 801

  • FLAG

  • N terminal on backbone

  • pRS316
    (Search Vector Database)

  • Yeast Expression

  • 6063

  • GAL1

  • NheI

  • No

  • XhoI

  • No

  • CTGGGGTAATTAATCAGCGAAGCG List of Sequencing Primers


  • Ampicillin

  • XL1 Blue

  • 37

  • High Copy

  • URA3

  • Plasmid pRS316 from PMID:2659436

  • View sequences (4)
  • Dane Wittrup


Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 45831" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with
41843: pCTcon2
45830: pRS314-4M5.3