Plasmid 45831: pRS316-4M5.3
  • 4M5.3

  • 801

  • FLAG

  • N terminal on backbone

  • pRS316
    (Search Vector Database)

  • Yeast Expression

  • 6063

  • GAL1

  • NheI

  • No

  • XhoI

  • No

  • CTGGGGTAATTAATCAGCGAAGCG List of Sequencing Primers


  • Ampicillin

  • XL1 Blue

  • 37

  • High Copy

  • URA3

  • Plasmid pRS316 from PMID:2659436

  • View sequences (4)
  • Dane Wittrup


Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 45831" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with
45830: pRS314-4M5.3
41843: pCTcon2