Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #46387)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 46387 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4242
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    CLDN1 Promoter
  • Species
    H. sapiens (human)
  • GenBank ID
  • Entrez Gene
    CLDN1 (a.k.a. CLD1, ILVASC, SEMP1)
  • Promoter CLDN1 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TAGCAAAATAGGCTGTCCCC
  • 3′ sequencing primer GCTGGGCCCTTCTTAATGTT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL4.10-Claudin-1 was a gift from David Mu (Addgene plasmid # 46387 ; ; RRID:Addgene_46387)
  • For your References section:

    Occludin is a direct target of thyroid transcription factor-1 (TTF-1/NKX2-1). Runkle EA, Rice SJ, Qi J, Masser D, Antonetti DA, Winslow MM, Mu D. J Biol Chem. 2012 Aug 17;287(34):28790-801. doi: 10.1074/jbc.M112.367987. Epub 2012 Jul 2. 10.1074/jbc.M112.367987 PubMed 22761434