-
Purposesensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 48761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 9240
- Total vector size (bp) 10866
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemacQ-mOrange
-
SpeciesL. maculans
-
Insert Size (bp)1626
-
Mutationmac-D139Q
- Promoter CamKIIa
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ctgacgaaggctcgcgaggc
- 3′ sequencing primer gccatacgggaagcaatagcatg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: the full sequence does not include the noted mac-D139Q mutation. This mutation was confirmed in the Addgene QC sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CamkII-MacQ-mOrange2 was a gift from Mark Schnitzer (Addgene plasmid # 48761 ; http://n2t.net/addgene:48761 ; RRID:Addgene_48761) -
For your References section:
Imaging neural spiking in brain tissue using FRET-opsin protein voltage sensors. Gong Y, Wagner MJ, Zhong Li J, Schnitzer MJ. Nat Commun. 2014 Apr 22;5:3674. doi: 10.1038/ncomms4674. 10.1038/ncomms4674 PubMed 24755708