-
PurposeDouble floxed mCherry under the control of EF1a promoter
-
Depositing Lab
-
Publication
-
Sequence Information
-
Depositor Sequences: None.
-
Addgene Sequences: Full (1) Partial (2)
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 50462 | Plasmid sent as bacteria in agar stab | 1 | $65 | ||
AAV5 | 50462-AAV5 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 6314
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesAequorea victoria
-
Insert Size (bp)715
- Promoter EF1a
-
Tag
/ Fusion Protein
- N/A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Asc I (not destroyed)
- 3′ cloning site Nhe I (not destroyed)
- 5′ sequencing primer TTTTTGAGTTTGGATCTTGG
- 3′ sequencing primer GCATTAAAGCAGCGTATCCACATAGC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Terms and Licenses
Depositor Comments
For more information, see: http://pdspit3.mml.unc.edu/projects/dreadd/wiki/WikiStart
Information for AAV5 (Catalog # 50462-AAV5) ( Back to top )
Addgene no longer distributes this item. Contact [email protected] for more information.
Purpose
Ready-to-use AAV5 particles produced from pAAV-EF1a-DIO-mCherry (#50462). In addition to the viral particles, you will also receive purified pAAV-EF1a-DIO-mCherry plasmid DNA.
EF1a-driven mCherry-expression control. Cre-dependent. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume .
- Titer ≥ 3×10¹² vg/mL
- Pricing $350 USD for preparation of . virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
- Envelope AAV5 cap gene
- Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
- Serotype AAV5
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mCherry
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Resource Information
-
Terms and Licenses
Viral Quality Control
- Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
- Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
- PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the DIO orientation. The PCR products were visualized on an agarose gel for size confirmation.
- DIO orientation
EF1a For: AGTCTTGTAAATGCGGGCCA
Cherry For: TCCGAGCGGATGTACCCCGAG - Non-DIO orientation
EF1a For: AGTCTTGTAAATGCGGGCCA
Cherry Rev: CTTGTACAGCTCGTCCATGCCG
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-DIO-mCherry was a gift from Bryan Roth (Addgene plasmid # 50462)
For viral preps, please replace (Addgene plasmid # 50462) in the above sentence with: (Addgene viral prep # 50462-AAV5)