pAAV-EF1a-DIO-mCherry
(Plasmid #50462)

• Purpose: Double floxed mCherry under the control of EF1a promoter
• Depositing Lab: Bryan Roth
• Publication: Roth lab DREADDs (unpublished)
• Sequence Information:

  • Depositor Sequences: None.
  • Addgene Sequences: Full (1) Partial (2)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	50462	Plasmid sent as bacteria in agar stab	1	$65	Add to Cart
AAV5	50462-AAV5		1 2 3 4 5 6 7 8 9 10 11 12 13 14 15	$380	Discontinued

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pAAV
  (Search Vector Database)
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 6314
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: mCherry
• Species: Aequorea victoria
• Insert Size (bp): 715
• Promoter: EF1a
• Tag / Fusion Protein:
  • N/A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Asc I (not destroyed)
• 3′ cloning site: Nhe I (not destroyed)
• 5′ sequencing primer: TTTTTGAGTTTGGATCTTGG
• 3′ sequencing primer: GCATTAAAGCAGCGTATCCACATAGC

Resource Information

• Addgene Notes:
  • Addgene diagnostic digest
• Terms and Licenses:
  • UBMTA
  • Clontech Limited Use Label License
  • genOway Notice of RIghts

Depositor Comments

For more information, see: http://pdspit3.mml.unc.edu/projects/dreadd/wiki/WikiStart

Information for AAV5 (Catalog # 50462-AAV5)

Item is discontinued.

Addgene no longer distributes this item. Contact for more information.

Purpose

Ready-to-use AAV5 particles produced from pAAV-EF1a-DIO-mCherry (#50462). In addition to the viral particles, you will also receive purified pAAV-EF1a-DIO-mCherry plasmid DNA.

EF1a-driven mCherry-expression control. Cre-dependent. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: .
• Titer: ≥ 3×10¹² vg/mL
• Pricing: $350 USD for preparation of . virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene
• Envelope: AAV5 cap gene
• Buffer: PBS + 0.001% Pluronic F-68 + 200 mM NaCl
• Serotype: AAV5
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: mCherry

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Terms of Use for Viral Vectors

Viral Quality Control

Titering Method:

• Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.

Notes:

• Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
• PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the DIO orientation. The PCR products were visualized on an agarose gel for size confirmation.
• DIO orientation
  EF1a For: AGTCTTGTAAATGCGGGCCA
  Cherry For: TCCGAGCGGATGTACCCCGAG
• Non-DIO orientation
  EF1a For: AGTCTTGTAAATGCGGGCCA
  Cherry Rev: CTTGTACAGCTCGTCCATGCCG

Visit our viral production page for more information.