ShuttleMCP
(Plasmid #50959)

• Purpose: (Empty Backbone) A backbone for adenovirus creation by the AdEasy method, similar to ShuttleCMV (Addgene Plasmid # 16403), except it uses a mouse cofilin promoter (MCP) instead of the CMV promoter
• Depositing Lab: James Bamburg
• Publication: Mi et al PLoS One. 2013 Dec 31;8(12):e83609. doi: 10.1371/journal.pone.0083609.

Backbone

• Vector backbone: pShuttle
• Backbone manufacturer: Bert Vogelstein lab (Addgene Plasmid #16402)
• Backbone size (bp): 8507
• Modifications to backbone: A 1255 bp region of the mouse cofilin 1 gene in BAC RP-23-457M2 just upstream of the start codon was amplified by PCR using the following primers containing a KpnI site: 5’ TTTCTAGATGGTACCGCTTCGGCCTCCACCTGG, 3’ TCTTCTAGAGGTACCGGGAGACAGAAAGAGCAACTG. KpnI-cut MCP DNA was then ligated into the KpnI site of pShuttle. A 710 bp polyadenylation sequence from the 3’UTR of the mouse cofilin-1 gene was amplified from the BAC template using PCR primers that contained a BglII site using the following primers: 5’ TTCAAGATCTGCCGTCATTTCCCTGGAGG, 3’ TTCAAGATCTGAGCCCAACTGCCCTGCC. This polyadenylation sequence was also cloned into the BglII site of pShuttle to generate pShuttle-MCP.
• Vector type: Mammalian Expression, Adenoviral
• Promoter: uses portion of the mouse cofilin gene as a mouse cofilin promoter (MCP)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Low Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: Encap-F (5'-TTTGGGCGTAACCGAGTAAG-3')
• 3′ sequencing primer: pShuttle-R (5'-CACAATGCTTCCATCAAACG-3')

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA