Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

ShuttleMCP
(Plasmid #50959)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50959 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pShuttle
  • Backbone manufacturer
    Bert Vogelstein lab (Addgene Plasmid #16402)
  • Backbone size (bp) 8507
  • Modifications to backbone
    A 1255 bp region of the mouse cofilin 1 gene in BAC RP-23-457M2 just upstream of the start codon was amplified by PCR using the following primers containing a KpnI site: 5’ TTTCTAGATGGTACCGCTTCGGCCTCCACCTGG, 3’ TCTTCTAGAGGTACCGGGAGACAGAAAGAGCAACTG. KpnI-cut MCP DNA was then ligated into the KpnI site of pShuttle. A 710 bp polyadenylation sequence from the 3’UTR of the mouse cofilin-1 gene was amplified from the BAC template using PCR primers that contained a BglII site using the following primers: 5’ TTCAAGATCTGCCGTCATTTCCCTGGAGG, 3’ TTCAAGATCTGAGCCCAACTGCCCTGCC. This polyadenylation sequence was also cloned into the BglII site of pShuttle to generate pShuttle-MCP.
  • Vector type
    Mammalian Expression, Adenoviral
  • Promoter uses portion of the mouse cofilin gene as a mouse cofilin promoter (MCP)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer Encap-F (5'-TTTGGGCGTAACCGAGTAAG-3')
  • 3′ sequencing primer pShuttle-R (5'-CACAATGCTTCCATCAAACG-3')
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ShuttleMCP was a gift from James Bamburg (Addgene plasmid # 50959 ; http://n2t.net/addgene:50959 ; RRID:Addgene_50959)
  • For your References section:

    A genetically encoded reporter for real-time imaging of cofilin-actin rods in living neurons. Mi J, Shaw AE, Pak CW, Walsh KP, Minamide LS, Bernstein BW, Kuhn TB, Bamburg JR. PLoS One. 2013 Dec 31;8(12):e83609. doi: 10.1371/journal.pone.0083609. PubMed 24391794