-
PurposeDre-responsive fluorescent reporter plasmid containing a STOP-cassette flanked by Dre-recognition sites (rox) followed by ZsGreen
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDIRECT
-
Backbone manufacturerCLONTECH
- Backbone size w/o insert (bp) 4814
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl2
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameroxSTOProx-ZsGreen
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer CATGCCTTCTTCTTTTTCCTAC
- 3′ sequencing primer GGAAAGGACAGTGGGAGTGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-roxSTOProx-ZsGreen was a gift from Pawel Pelczar (Addgene plasmid # 51274 ; http://n2t.net/addgene:51274 ; RRID:Addgene_51274) -
For your References section:
Binary recombinase systems for high-resolution conditional mutagenesis. Hermann M, Stillhard P, Wildner H, Seruggia D, Kapp V, Sanchez-Iranzo H, Mercader N, Montoliu L, Zeilhofer HU, Pelczar P. Nucleic Acids Res. 2014 Jan 9. 10.1093/nar/gkt1361 PubMed 24413561