-
PurposeExpresses Cas9-nickase in mammalian cells and zygotes.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51638 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
- Total vector size (bp) 9293
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCodon-optimized Cas9 D10A
-
Alt namehCas9 D10A
-
Alt namehCas9-nickase
-
SpeciesSynthetic
-
Insert Size (bp)4218
- Promoter CAG promoter
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- polyA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGTCCCCTTCTCCCTCTC
- 3′ sequencing primer ATTTTTGGCAGAGGGAAAAAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe human codon-optimized hCas9 insert in this vector was amplified from plasmid hCas9 (George Church; Addgene #41815) and D10A mutation was induced by PCR.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid vector was constructed by mutation PCR of pCAG-T3-hCAS9-pA plasmid vector (Addgene plasmid 48625) using the primers (Forward primer, 5’-AGTACTCCATTGGGCTCGccATCGGCACAAAC, and Reverse primer, 5’-CGAGCCCAATGGAGTACTTCTTGTCGGCTGC).
For the in vitro synthesis of CAS9 D10A mRNAs, the vector was linearized by SphI and in-vitro transcribed using T3-RNA-polymerase (Promega) in the presence of m7G(5′)ppp(5′)G to synthesize capped RNA.
The Tbpl1 3′UTR 95 nucleotide polyA tail at the 3' end of the insert allows in vitro transcribed mRNA from this plasmid to be used directly for microinjection into animal embryos or oocytes without additional polyadenylation treatment.
The CAG promoter in this plasmid also allows it to be used as a CAS9-expression vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-T3-hCasD10A-pA was a gift from Wataru Fujii (Addgene plasmid # 51638 ; http://n2t.net/addgene:51638 ; RRID:Addgene_51638) -
For your References section:
Efficient generation of genome-modified mice via offset-nicking by CRISPR/Cas system. Fujii W, Onuma A, Sugiura K, Naito K. Biochem Biophys Res Commun. 2014 Jan 31. pii: S0006-291X(14)00176-4. doi: 10.1016/j.bbrc.2014.01.141. 10.1016/j.bbrc.2014.01.141 PubMed 24491566