This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCAG-T3-hCasD10A-pA
(Plasmid #51638)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51638 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Codon-optimized Cas9 D10A
  • Alt name
    hCas9 D10A
  • Alt name
    hCas9-nickase
  • Species
    Synthetic
  • Insert Size (bp)
    4218
  • Promoter CAG promoter
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
    • polyA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGTCCCCTTCTCCCTCTC
  • 3′ sequencing primer ATTTTTGGCAGAGGGAAAAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The human codon-optimized hCas9 insert in this vector was amplified from plasmid hCas9 (George Church; Addgene #41815) and D10A mutation was induced by PCR.
  • Terms and Licenses

Depositor Comments

This plasmid vector was constructed by mutation PCR of pCAG-T3-hCAS9-pA plasmid vector (Addgene plasmid 48625) using the primers (Forward primer, 5’-AGTACTCCATTGGGCTCGccATCGGCACAAAC, and Reverse primer, 5’-CGAGCCCAATGGAGTACTTCTTGTCGGCTGC).

For the in vitro synthesis of CAS9 D10A mRNAs, the vector was linearized by SphI and in-vitro transcribed using T3-RNA-polymerase (Promega) in the presence of m7G(5′)ppp(5′)G to synthesize capped RNA.

The Tbpl1 3′UTR 95 nucleotide polyA tail at the 3' end of the insert allows in vitro transcribed mRNA from this plasmid to be used directly for microinjection into animal embryos or oocytes without additional polyadenylation treatment.

The CAG promoter in this plasmid also allows it to be used as a CAS9-expression vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-T3-hCasD10A-pA was a gift from Wataru Fujii (Addgene plasmid # 51638)
  • For your References section:

    Efficient generation of genome-modified mice via offset-nicking by CRISPR/Cas system. Fujii W, Onuma A, Sugiura K, Naito K. Biochem Biophys Res Commun. 2014 Jan 31. pii: S0006-291X(14)00176-4. doi: 10.1016/j.bbrc.2014.01.141. 10.1016/j.bbrc.2014.01.141 PubMed 24491566