CAG:: ChR2HA-2a-hM4D
(Plasmid #52520)

• Purpose: Co-expresses HA tagged channelrhodopsin and hM4D
• Depositing Lab: Scott Sternson
• Publication: Stachniak et al Neuron. 2014 May 21;82(4):797-808. doi: 10.1016/j.neuron.2014.04.008. Epub 2014 Apr 24.

Backbone

• Vector backbone: M18
• Backbone size w/o insert (bp): 5936
• Total vector size (bp): 8427
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ChR2-2a-hM4D
• Alt name: Channelrhodopsin-2
• Alt name: muscarinic receptor 4, variant
• Species: H. sapiens (human); Chlamydomonas reinhardtii
• Insert Size (bp): 2940
• Promoter: CAG
• Tag / Fusion Protein:
  • 2xHA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: ggttcggcttctggcgtgtgacc
• 3′ sequencing primer: CATAAAGAGACAGCAACCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Bryan Roth, UNC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

There is a minor discrepancy between Addgene's quality control sequence and the full plasmid reference sequence provided by the depositing lab. The mismatch causes a V to G change in the T2A linker region between the HA tag and hM4D.