Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-hSyn Con/Fon hChR2(H134R)-EYFP
(Plasmid #55645)


Item Catalog # Description Quantity Price (USD)
Plasmid 55645 Standard format: Plasmid sent in bacteria as agar stab 1 $65
AAV5 55645-AAV5 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. More Information
AAV8 55645-AAV8 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. More Information
AAV Retrograde 55645-AAVrg Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. More Information

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4800
  • Total vector size (bp) 6910
  • Vector type
    Mammalian Expression, AAV ; Cre on/Flp on ChR2-EYFP

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter hSyn
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer ccacgcgaggcgcgagatag
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Information for AAV5 (Catalog # 55645-AAV5) ( Back to top )


Ready-to-use AAV5 particles produced from pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (#55645). In addition to the viral particles, you will also receive purified pAAV-hSyn Con/Fon hChR2(H134R)-EYFP plasmid DNA.

Synapsin-driven, Cre-dependent and Flp-dependent channelrhodopsin-EYFP expression for optogenetic activation. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EYFP


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP/LoxN sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.01-0.03% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.

Information for AAV8 (Catalog # 55645-AAV8) ( Back to top )


Ready-to-use AAV8 particles produced from pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (#55645). In addition to the viral particles, you will also receive purified pAAV-hSyn Con/Fon hChR2(H134R)-EYFP plasmid DNA.

Synapsin-driven, Cre-dependent and Flp-dependent Channelrhodopsin-EYFP expression for optogenetic activation. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EYFP


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP/LoxN sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.01-0.03% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.

Information for AAV Retrograde (Catalog # 55645-AAVrg) ( Back to top )


Ready-to-use AAV Retrograde particles produced from pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (#55645). In addition to the viral particles, you will also receive purified pAAV-hSyn Con/Fon hChR2(H134R)-EYFP plasmid DNA.

Synapsin-driven, Cre-dependent and Flp-dependent Channelrhodopsin-EYFP expression for optogenetic activation. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.


  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EYFP


Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.

Using FLEX vectors in vivo: LoxP/LoxN sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.01-0.03% of viral vectors in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, we recommend titrating to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral vector dosage in order to reduce the likelihood of Cre-independent expression.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn Con/Fon hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 55645 ; ; RRID:Addgene_55645)

    For viral preps, please replace (Addgene plasmid # 55645) in the above sentence with: (Addgene viral prep # 55645-AAV5), (Addgene viral prep # 55645-AAV8), or (Addgene viral prep # 55645-AAVrg)

  • For your References section:

    Targeting cells with single vectors using multiple-feature Boolean logic. Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu A, Berndt A, Grosenick L, Zalocusky KA, Bernstein H, Swanson H, Perry C, Diester I, Boyce FM, Bass CE, Neve R, Huang ZJ, Deisseroth K. Nat Methods. 2014 Jul;11(7):763-72. doi: 10.1038/nmeth.2996. Epub 2014 Jun 8. 10.1038/nmeth.2996 PubMed 24908100