This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-hSyn Con/Fon hChR2(H134R)-EYFP
(Plasmid #55645)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 55645 Plasmid sent as bacteria in agar stab 1 $65
AAV8 55645-AAV8 Virus (100 µL at titer ≥ 1×10¹³ vg/mL)
and Plasmid. More Information
$380
AAV Retrograde 55645-AAVrg Virus (100 µL at titer ≥ 7×10¹² vg/mL)
and Plasmid. More Information
$380

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 4800
  • Total vector size (bp) 6910
  • Vector type
    Mammalian Expression, AAV ; Cre on/Flp on ChR2-EYFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ChR2(H134R)-EYFP
  • Species
    Synthetic
  • Insert Size (bp)
    2110
  • Promoter hSyn
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer ccacgcgaggcgcgagatag
  • 3′ sequencing primer GCAATAGCATGATACAAAGG
  • (Common Sequencing Primers)

Resource Information

Information for AAV8 (Catalog # 55645-AAV8) ( Back to top )

Purpose

Ready-to-use AAV8 particles produced from pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (#55645). In addition to the viral particles, you will also receive purified pAAV-hSyn Con/Fon hChR2(H134R)-EYFP plasmid DNA.

Synapsin-driven, Cre-dependent and Flp-dependent Channelrhodopsin-EYFP expression for optogenetic activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EYFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Real-time qPCR or digital droplet PCR: The number of genome copies in viral preparations was measured by real-time qPCR or by digital droplet PCR. Titering on these preparations was performed by the University of Pennsylvania Vector Core. Read Addgene's AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the original (non-flipped) orientation. PCR was also carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene + Orientation
      WPRE Rev: GCAGAATCCAGGTGGCAACA
      EYFP INTRSECT For: ACGTAAACGGCCACAAGTTC
    • Transgene + Orientation (no amplicon expected)
      WPRE Rev: GCAGAATCCAGGTGGCAACA
      EYFP INTRSECT Rev: TTCAGGGTCAGCTTGCCGTA
    • Transgene + Orientation
      Syn For: CAAGCACCCAACCCCCATTCCC
      Citrine For: CAACGTCTATATCATGGCCGACAAGC
    • Transgene + Orientation (no amplicon expected)
      Syn For: CAAGCACCCAACCCCCATTCCC
      Citrine Rev: CTTGTACAGCTCGTCCATGCCG

Visit our viral production page for more information.

Information for AAV Retrograde (Catalog # 55645-AAVrg) ( Back to top )

Purpose

Ready-to-use AAV Retrograde particles produced from pAAV-hSyn Con/Fon hChR2(H134R)-EYFP (#55645). In addition to the viral particles, you will also receive purified pAAV-hSyn Con/Fon hChR2(H134R)-EYFP plasmid DNA.

Synapsin-driven, Cre-dependent and Flp-dependent Channelrhodopsin-EYFP expression for optogenetic activation. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene
  • Envelope AAV retrograde cap gene
    rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAVrg rAAV2-retro helper (plasmid #81070)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene EYFP

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

Viral Quality Control

Titering Method:
  • Real-time qPCR: The number of genome copies in viral preparations was measured by SYBR green real-time qPCR with primers targeting the ITR. Titer values were deduced by comparing the genomic content of the viral preparation to a standard curve of a plasmid of known concentration. Read our AAV Titration by qPCR protocol here.
Notes:
  • Purity of viral preparation: Viral preparations were subjected to polyacrylamide gel electrophoresis (PAGE) followed by silver staining and the molecular weight and relative intensity of the viral capsid proteins was analyzed. The abundance of viral capsid proteins as a fraction of total protein present in the sample was used to determine purity of the AAV preparation.
  • PCR confirmation of viral genome: PCR was carried out on the viral preparation with primers that only produce amplicons in the original (non-flipped) orientation. PCR was also carried out on the viral preparation with primers targeting the transgene. The PCR products were visualized on an agarose gel for size confirmation.
    • Transgene + Orientation
      WPRE Rev: GCAGAATCCAGGTGGCAACA
      INTRSECT For: ACGTAAACGGCCACAAGTTC
    • Transgene + Orientation (no amplicon expected)
      WPRE Rev: GCAGAATCCAGGTGGCAACA
      INTRSECT Rev: TTCAGGGTCAGCTTGCCGTA
    • Transgene + Orientation
      Syn For: CAAGCACCCAACCCCCATTCCC
      Citrine For: CTTGTACAGCTCGTCCATGCCG
    • Transgene + Orientation (no amplicon expected)
      Syn For: CAAGCACCCAACCCCCATTCCC
      Citrine Rev: CTTGTACAGCTCGTCCATGCCG

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn Con/Fon hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 55645)

    For viral preps, please replace (Addgene plasmid # 55645) in the above sentence with: (Addgene viral prep # 55645-AAV8) or (Addgene viral prep # 55645-AAVrg)