Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

HSC1-HS4-GiP
(Plasmid #58540)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58540 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    HSC1 retroviral vector
  • Backbone size w/o insert (bp) 4941
  • Total vector size (bp) 8805
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Enhanced Green Fluorescence Protein, Puromycin resistance gene
  • Alt name
    EiP
  • Insert Size (bp)
    1945
  • Promoter Human EF1-alpha

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ctcgatcctccctttatcca
  • 3′ sequencing primer ccatatgatcgatgcatggg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Core HS4 insulator sequence (dimer)
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    526

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer cccatgcatcgatcatatgg
  • 3′ sequencing primer ctgttacccatgaaagaccc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HSC1-HS4-GiP was a gift from James Ellis (Addgene plasmid # 58540 ; http://n2t.net/addgene:58540 ; RRID:Addgene_58540)
  • For your References section:

    Kinetics and epigenetics of retroviral silencing in mouse embryonic stem cells defined by deletion of the D4Z4 element. Rival-Gervier S, Lo MY, Khattak S, Pasceri P, Lorincz MC, Ellis J. Mol Ther. 2013 Aug;21(8):1536-50. doi: 10.1038/mt.2013.131. Epub 2013 Jun 11. 10.1038/mt.2013.131 PubMed 23752310