pXPR_011
(Plasmid #59702)

• Purpose: This lentiviral vector can be used to assay Cas9 activity.
• Depositing Labs: John Doench, David Root
• Publication: Doench et al Nat Biotechnol. 2014 Sep 3. doi: 10.1038/nbt.3026.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	59702	Standard format: Plasmid sent in bacteria as agar stab	1	$65	Add to Cart
Lentiviral Prep	59702-LV	Virus (1mL at titer > 1x10⁶ TU/mL) and Plasmid. More Information	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15	$130	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pLKO.1
  (Search Vector Database)
• Total vector size (bp): 8395
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP sgRNA
• Species: Synthetic
• Promoter: hU6

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: LKO.1 5'

Resource Information

• Terms and Licenses:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
  • Institut Pasteur Label License for cPPT
• Articles Citing this Plasmid:
  • 3 References

Depositor Comments

This lentiviral vector can be used to assay Cas9 activity. In the absence of Cas9, the cells are both resistant to puromycin and express EGFP. In the presence of functional levels of Cas9, the sgRNA expressed from the U6 cassette targets EGFP, and thus cells will still be puromycin-resistant, but will no longer express EGFP. The fraction of EGFP-positive and -negative cells can be accurately quantitated by flow cytometry. Please note that it is unlikely that 100% of cells will ever be EGFP-negative, as a fraction of cells are likely to have in-frame indels, and those the cells may still be green. This assay is best done with cells infected with pXPR_011 at an MOI <1.

Information for Lentiviral Prep (Catalog # 59702-LV)

Purpose

Ready-to-use Lentiviral Prep particles produced from pXPR_011 (#59702). In addition to the viral particles, you will also receive purified pXPR_011 plasmid DNA.

Lentiviral particles carrying a GFP and puromycin resistance. This virus can be used as a control for assessing Cas9 activity.

Delivery

• Volume: 1mL
• Titer: ≥1x10⁶ TU/mL
• Pricing: $100 USD for preparation of 1mL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: psPAX2 (plasmid #12260)
• Envelope: pMD2.G (plasmid #12259)
• Buffer: DMEM +10% FBS
• Selectable Marker: Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Terms of Use for Viral Vectors

Viral Quality Control

Titering Method:

• Colony formation assay: A549 cells were transduced with serial dilutions of 59702-LV and treated with puromycin. Puromycin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.

Notes:

• PCR confirmation of insert: PCR confirmation of insert: PCR was carried out with primers targeting the GFP and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
  Forward Primer: EGFP-C CATGGTCCTGCTGGAGTTCGTG
  Reverse Primer: WPRE-R CATAGCGTAAAAGGAGCAACA
• Confirmation of protein expression: HeLa cells were transduced with 59702-LV. 96 hours later, GFP expression was visualized with direct fluorescence. You can view the GFP expression here or in the image section at the top of this page.

Visit our viral production page for more information.