Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1-dCas9-CibN
(Plasmid #60552)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60552 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5333
  • Total vector size (bp) 10118
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-CibN
  • Species
    A. thaliana (mustard weed); S. pyogenes
  • Insert Size (bp)
    4785
  • Mutation
    inactivating Cas9 mutations D10A and H840A
  • Promoter CMV
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • SV40 NLS (N terminal on insert)
    • SV40 NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTGACGCAAATGGGCGGTAGGCGTGT
  • 3′ sequencing primer GCC TGC TAT TGT CTT CCC AAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-dCas9-CibN was a gift from Charles Gersbach (Addgene plasmid # 60552 ; http://n2t.net/addgene:60552 ; RRID:Addgene_60552)
  • For your References section:

    A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Polstein LR, Gersbach CA. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753. 10.1038/nchembio.1753 PubMed 25664691