-
PurposeExpresses CibN-dCas9-CibN in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60553 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5333
- Total vector size (bp) 10632
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-CibN
-
SpeciesA. thaliana (mustard weed); S. pyogenes
-
Insert Size (bp)5298
-
Mutationinactivating Cas9 mutations D10A and H840A
- Promoter CMV
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- SV40 NLS (N terminal on insert)
- SV40 NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTGACGCAAATGGGCGGTAGGCGTGT
- 3′ sequencing primer GCC TGC TAT TGT CTT CCC AAT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-CibN-dCas9-CibN was a gift from Charles Gersbach (Addgene plasmid # 60553 ; http://n2t.net/addgene:60553 ; RRID:Addgene_60553) -
For your References section:
A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Polstein LR, Gersbach CA. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753. 10.1038/nchembio.1753 PubMed 25664691