Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

DR5rev::erRFP
(Plasmid #61011)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61011 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHGWL7,0
  • Total vector size (bp) 11908
  • Vector type
    Plant Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DR5rev::erRFP:35S_term
  • Species
    Synthetic
  • Insert Size (bp)
    1500
  • Promoter DR5rev::erRFP:35Sterm

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CACCTCGACGGTATCGCGCCCAGGG
  • 3′ sequencing primer CGTAGCGAGACCACAGGAGCATGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DR5rev::erRFP was a gift from Alexis Maizel (Addgene plasmid # 61011 ; http://n2t.net/addgene:61011 ; RRID:Addgene_61011)
  • For your References section:

    miR390, Arabidopsis TAS3 tasiRNAs, and their AUXIN RESPONSE FACTOR targets define an autoregulatory network quantitatively regulating lateral root growth. Marin E, Jouannet V, Herz A, Lokerse AS, Weijers D, Vaucheret H, Nussaume L, Crespi MD, Maizel A. Plant Cell. 2010 Apr;22(4):1104-17. doi: 10.1105/tpc.109.072553. Epub 2010 Apr 2. 10.1105/tpc.109.072553 PubMed 20363771